View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20731_low_15 (Length: 236)
Name: NF20731_low_15
Description: NF20731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20731_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 59 - 230
Target Start/End: Complemental strand, 42995443 - 42995270
Alignment:
| Q |
59 |
tacatagttgagtatgatgtcgaagatgtgggtagtccttcctcatcttgctgtcgtttcatcctggggttt-attgttactgttattg-caattagata |
156 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
42995443 |
tacatatttgagtatgtcgtcgaagatgtgggtagtccttcctcatgttgccatcgtttcatcctagggttttattgttactgttattggcaattagata |
42995344 |
T |
 |
| Q |
157 |
tttgaaatttggtggcatgcttaagagttggaggatggagttttcaagtttatttggtttttgtttgatgatgt |
230 |
Q |
| |
|
| |||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42995343 |
tctgaaatttggtggcatgcttcagagttagaggatggagttttcaagtttttttggtttttgtttgatgatgt |
42995270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 17559590 - 17559530
Alignment:
| Q |
1 |
ttttaactgcacagtttttcatgatttagaaatcaattagtgattaaagccacacatctac |
61 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17559590 |
ttttaactgcatagtttttcatgatttagaaatcaatcagtgattaaagccacacatctac |
17559530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University