View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20731_low_17 (Length: 226)
Name: NF20731_low_17
Description: NF20731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20731_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 6 - 189
Target Start/End: Complemental strand, 20518172 - 20517990
Alignment:
| Q |
6 |
attaattacctattaaatataattcaaaatattcaattaacttaatctttttgaaggaaggaaatcttggctcctaggcta-tttgatataaaataaaat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20518172 |
attaattacctattaaatataattcaaaatattcaattaacttaatc--tttgaaggaatgaaatcttggctcctaggctattttgatataaaataaaat |
20518075 |
T |
|
| Q |
105 |
tagccaacaatttcactatttcgannnnnnnnaaagaatttaactattttgattattgtcgaaatttattaagtttatgtcaaaa |
189 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
20518074 |
tagccaacaatttcactatttcgattttttttaaagaatttaactattttgattattgtcgaaatttattaagtttgtgtcaaaa |
20517990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University