View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20733_low_4 (Length: 310)
Name: NF20733_low_4
Description: NF20733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20733_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 4305317 - 4305187
Alignment:
| Q |
1 |
aaaataagtttcaaaataaaattgatgttaatggttcggtcgaggtatcttttaataattctcaattgtgattgtctttgtgatttaaatgattacgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||| |||||||||||| | ||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
4305317 |
aaaataagtttcaaaataaaattgatgctaattgtttggtcgaggtatcatctaataattctcaattttgattttctttgtgatttaaatgattacgttg |
4305218 |
T |
|
| Q |
101 |
aggaagatattatgttttaaaaccgtgaatt |
131 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |
|
|
| T |
4305217 |
aggaagatattatgttttaaaaccatgaatt |
4305187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University