View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20734_high_9 (Length: 257)

Name: NF20734_high_9
Description: NF20734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20734_high_9
NF20734_high_9
[»] chr5 (1 HSPs)
chr5 (2-240)||(11362027-11362265)


Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 11362265 - 11362027
Alignment:
2 agagaaacgaatatagaaagtactactatgatctgaaactactactaggctacatgatacggacaaaactcaaattcagagatcagnnnnnnngaacgtt 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||       |||||||    
11362265 agagaaacgaatatagaaagtactactatgatctgaaactactactaggctacatgatacggacaaaaatcaaattcagagatcagtttttttgaacgtt 11362166  T
102 gatatagcaaaacgaaaatcacaaacacgaaaattgaattgagagaaattacatttgtcgatagattcctcttgcataaccatgtcttcttcttcaataa 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||    
11362165 gatatagcaaaacgaaaatcacaaacacgaaaattgaattgagagaaattacatttgtcgatagattcctcttccataatcatgtcttcttcttcaataa 11362066  T
202 ggtgcatgtgattgttcgtctcttcgataaccatatctg 240  Q
    | ||||||||||||||||||||||| |||||||||||||    
11362065 gctgcatgtgattgttcgtctcttccataaccatatctg 11362027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University