View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20734_high_9 (Length: 257)
Name: NF20734_high_9
Description: NF20734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20734_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 11362265 - 11362027
Alignment:
| Q |
2 |
agagaaacgaatatagaaagtactactatgatctgaaactactactaggctacatgatacggacaaaactcaaattcagagatcagnnnnnnngaacgtt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
11362265 |
agagaaacgaatatagaaagtactactatgatctgaaactactactaggctacatgatacggacaaaaatcaaattcagagatcagtttttttgaacgtt |
11362166 |
T |
|
| Q |
102 |
gatatagcaaaacgaaaatcacaaacacgaaaattgaattgagagaaattacatttgtcgatagattcctcttgcataaccatgtcttcttcttcaataa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
11362165 |
gatatagcaaaacgaaaatcacaaacacgaaaattgaattgagagaaattacatttgtcgatagattcctcttccataatcatgtcttcttcttcaataa |
11362066 |
T |
|
| Q |
202 |
ggtgcatgtgattgttcgtctcttcgataaccatatctg |
240 |
Q |
| |
|
| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11362065 |
gctgcatgtgattgttcgtctcttccataaccatatctg |
11362027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University