View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_high_16 (Length: 294)
Name: NF20736_high_16
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 26425485 - 26425759
Alignment:
| Q |
1 |
ctttcttgcaatacaccacattcacctaataacaaaaactactttacttgcatattttagcttccttttaaactcctataaatgatgaaaaacaaccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26425485 |
ctttcttgcaatacaccacattcacctaataa-aaaaactactttacttgcatattttagcttccttttaaactcctataaatgatgaaaaataaccaat |
26425583 |
T |
 |
| Q |
101 |
gcaaattcaggaaatcttcataaattaagtagccatgaaatcttctttaattgcattttctgctcttgtgcttctcatctttgttgcctcaaattcagag |
200 |
Q |
| |
|
||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26425584 |
gcagattcaggaaaacttgataaattaagtagccatgaaatcttctttaattgcattttctgctcttgtgcttctcatctttgttgcctcaaattcagag |
26425683 |
T |
 |
| Q |
201 |
gctgcaatttcatgcagtgatgtgattaaggacttgaaaccttgtgtgagctatttggttagtggaagtggacaac |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26425684 |
gctgcaatttcatgcagtgatgtgattaaggacttgaaaccttgtgtgagctatttggttagtggaagtggacaac |
26425759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University