View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_high_18 (Length: 286)
Name: NF20736_high_18
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 75 - 270
Target Start/End: Complemental strand, 41548341 - 41548139
Alignment:
| Q |
75 |
aagtaagtacaaggaatactcgaatccagcaacatac------tatcctcgttaaaagggtaa-taaactttaccttccatcgatcgtgatacgaggctt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41548341 |
aagtaagtacaaggaatactcgaatccagcaacatatatataatatcctcgttgaaagggtaaataaactttaccttccatcgatagtgatacgaggctt |
41548242 |
T |
|
| Q |
168 |
tctagctgctttacctcctgattttattttaagagcgtcacccaatttctcagtaaccacccattcatttaccctacctgcctcaaacaaacctataagt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548241 |
tctagctgctttacctcctgattttattttaagagcgtcacccaatttctcagtaaccacccattcatttaccctacctgcctcaaacaaacctataagt |
41548142 |
T |
|
| Q |
268 |
gtt |
270 |
Q |
| |
|
||| |
|
|
| T |
41548141 |
gtt |
41548139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Complemental strand, 41548410 - 41548369
Alignment:
| Q |
15 |
atgaatcctgttttaacatcaacaaacaagtagaaaagtgag |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41548410 |
atgaatcctgttttaacatcaacaaacaagtagaaaagtgag |
41548369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University