View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_low_19 (Length: 282)
Name: NF20736_low_19
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 44 - 263
Target Start/End: Original strand, 41481460 - 41481682
Alignment:
| Q |
44 |
gtgtttcaagattatgttgatagagattggttatgtgaactaaatcataacatttgctactagaaacttatcaaatagaaaccaaaatcatgttgaagaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41481460 |
gtgtttcaagattatgttgatagagattggttatgtgaactaaatcataacatttgctactagaaacttatcaaatagaaaccaaaatcatgttgaagaa |
41481559 |
T |
 |
| Q |
144 |
---tatgcgtccctctatattttactccacttgttagaattttttcaatgtattctacattttgttggcttatgtgattgttgttagtcactaaatttaa |
240 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
41481560 |
gaatatgtgtccctctatattttactccacttgttagaattttttcaatgtattctacattttgttggcttatgtgattgttgttagtcaataaattcaa |
41481659 |
T |
 |
| Q |
241 |
tttgggcaacaattaaaaggtat |
263 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41481660 |
tttgggcaacaattaaaaggtat |
41481682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University