View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_low_23 (Length: 252)
Name: NF20736_low_23
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 38749106 - 38749278
Alignment:
| Q |
1 |
tgacttagtatagtt--ttaccctacaaattctcattcataactccataatttgctggataagcatgcgataaaattgttggggcatgactcatgatcag |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38749106 |
tgacttagtatagttagttaccctacaaattctcattcataactccataatttgctggataagcatgcgataaaattgttggggcatgactcatgatcag |
38749205 |
T |
|
| Q |
99 |
gtctaagatatgg----tatattgag-taaaaacaattacataaatgagttgcaaatcaaatcttatcttaac |
166 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
38749206 |
gtctaagatatggcatatatattgagctaaaaacaattgcataaataagttgcaaatcaaatcttatcttaac |
38749278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University