View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_low_27 (Length: 240)
Name: NF20736_low_27
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 36800591 - 36800667
Alignment:
| Q |
18 |
aactctttcgtaagcttcatgaatgatgaaaccgccttttgtttcttctacttaaaatcattttcctttttccacgg |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36800591 |
aactctttcgtaagcttcatgaatgatgaaaccgccttttgtttcttctacttaaaatcattttcctttttccacgg |
36800667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 240
Target Start/End: Original strand, 36800761 - 36800816
Alignment:
| Q |
186 |
attgaattgaattcaatgcaaccaagt-aaaagacaaggtttcttttcctgttatt |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36800761 |
attgaattgaattcaatgcaaccaagtaaaaagacaaggtttcttttcctgttatt |
36800816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University