View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20736_low_27 (Length: 240)

Name: NF20736_low_27
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20736_low_27
NF20736_low_27
[»] chr7 (2 HSPs)
chr7 (18-94)||(36800591-36800667)
chr7 (186-240)||(36800761-36800816)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 18 - 94
Target Start/End: Original strand, 36800591 - 36800667
Alignment:
18 aactctttcgtaagcttcatgaatgatgaaaccgccttttgtttcttctacttaaaatcattttcctttttccacgg 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36800591 aactctttcgtaagcttcatgaatgatgaaaccgccttttgtttcttctacttaaaatcattttcctttttccacgg 36800667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 186 - 240
Target Start/End: Original strand, 36800761 - 36800816
Alignment:
186 attgaattgaattcaatgcaaccaagt-aaaagacaaggtttcttttcctgttatt 240  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
36800761 attgaattgaattcaatgcaaccaagtaaaaagacaaggtttcttttcctgttatt 36800816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University