View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_low_28 (Length: 238)
Name: NF20736_low_28
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 14 - 223
Target Start/End: Complemental strand, 226242 - 226037
Alignment:
| Q |
14 |
attatacttggacttttaactagattaatatactttgacttctacttattaggaaggatatatcattttttggttgtgggaaggatatatcatatcataa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226242 |
attatacttggacttttaactagattaatatactttgacttctacttattaggaaggatat--cattttttggttgtgggaaggatatatcatatcataa |
226145 |
T |
|
| Q |
114 |
tcaagcaaagaaatacattgggtgttaagtattcgtaaaatcccccattttaatttttgaagtctgaactaaaggtgatttgagtttataacttttgaac |
213 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
226144 |
tcaagcaa-gaaatacattgggtgttaagtattcgtaaaa-cccccattttactttttgaagtctgaactaaaggtgatttgagtttataacttttgaac |
226047 |
T |
|
| Q |
214 |
ttcaaattga |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
226046 |
ttcaaattga |
226037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University