View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20736_low_33 (Length: 212)
Name: NF20736_low_33
Description: NF20736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20736_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 66 - 177
Target Start/End: Complemental strand, 16881249 - 16881138
Alignment:
| Q |
66 |
taataaacatttgaaaaagtgatcctagaataatagccttnnnnnnngaagataaaaatgcttgaatgatggaaaagtgtacgttgaaagtgcaaaattc |
165 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
16881249 |
taataaacattcgaaaaagtgatactagaataatagccttaaaaaaaaaagataaaaatgcttgaatgatggaaaagtgtacgttgaaagtgcaaacttc |
16881150 |
T |
|
| Q |
166 |
atttacaatgat |
177 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16881149 |
atttacaatgat |
16881138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University