View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20738_high_12 (Length: 208)
Name: NF20738_high_12
Description: NF20738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20738_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 5703008 - 5703200
Alignment:
| Q |
1 |
gaagctaaaaccatcc-attaatttcaatttcaactaataatactgattatcataattaaagagtgatgcttatgctaaaacttttctcagctaatggac |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5703008 |
gaagctaaaaccatcccattaatttcaatttcaactaataatactgattatcataattaaagagtgatgcttatgctaaaacttttctcagctaatggac |
5703107 |
T |
 |
| Q |
100 |
gatgattgtgaaattttcttgtacgaattactgaattttctcctttccacttgattttttctttgtcatttcctctgcattctaggaattcct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5703108 |
gatgattgtgaaattttcttgtacgaattactgaattttctcctttccacttgattttttctttgtcatttcctctgcattctaggaattcct |
5703200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University