View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20738_low_5 (Length: 319)
Name: NF20738_low_5
Description: NF20738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20738_low_5 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 53 - 319
Target Start/End: Original strand, 12694102 - 12694368
Alignment:
| Q |
53 |
gcatttcatattcttgagcacgatttcatcagaaaaataatctagggcttaatttcaaatttagaggcaagtagcggatgttaaaattgttaacgagggt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
12694102 |
gcatttcatattcttgagcacgatttcatcagaaaaataacctagggtttaatttcaaatttagaggcaaataacggatgttaaaattgttaacgagggt |
12694201 |
T |
|
| Q |
153 |
gttagccaataaaattagttttagggaataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694202 |
gttagccaataaaattagttttagggaataagaaattgatttaacatgatcagcagaacaacatccggtgcaatgaagagtgatgacttctagcagtttg |
12694301 |
T |
|
| Q |
253 |
atgttctatgtgagggcacatatcatgccgtgggaactttatattgtatgatactccgaggggttat |
319 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694302 |
atgttctatgcgagggcacatatcatgccgtgggaactttatattgtatgatactccgaggggttat |
12694368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 12694070 - 12694109
Alignment:
| Q |
1 |
taaaaactaggatgtaattaaagaaagatgtggcatttca |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12694070 |
taaaaactaggatgtaattaaagaaagatgtggcatttca |
12694109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 270
Target Start/End: Complemental strand, 42448129 - 42448085
Alignment:
| Q |
226 |
tgaagagtgatgacttctagcagtttgatgttctatgtgagggca |
270 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| ||||||| |
|
|
| T |
42448129 |
tgaagagtgacgactttgagcagtttgatgttctatgcgagggca |
42448085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University