View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20738_low_9 (Length: 240)
Name: NF20738_low_9
Description: NF20738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20738_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 7500292 - 7500512
Alignment:
| Q |
1 |
ttttgtattgtgtcgataactacccaactcaacctcaaattttcatgcaaatattccgtccagtcccatctctctttctttaccggaatttgagtttcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500292 |
ttttgtattgtgtcgataactacccaactcaacctcaaattttcatgcaaatattccgtcctgtcccatctctctttctttaccggaatttgagtttcca |
7500391 |
T |
|
| Q |
101 |
gagaggaatagtctcttnnnnnnntcttaccgttggagtatatagtgaatttgttcataggttgaacttggatcttagtgaacaaaggctttggctctcc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7500392 |
gagaggaatagtctcttaaaaaaatcttaccgttggagtatatagtgaatttgttcataggttgaactcggatcttagtgaacaaaggctttggctctcc |
7500491 |
T |
|
| Q |
201 |
atgtaaagatatatcaatggc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7500492 |
atgtaaagatatatcaatggc |
7500512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 57
Target Start/End: Complemental strand, 8057726 - 8057682
Alignment:
| Q |
13 |
tcgataactacccaactcaacctcaaattttcatgcaaatattcc |
57 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
8057726 |
tcgataaccacccaactcaacctcaaattttctttcaagtattcc |
8057682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 56
Target Start/End: Complemental strand, 27257839 - 27257796
Alignment:
| Q |
13 |
tcgataactacccaactcaacctcaaattttcatgcaaatattc |
56 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27257839 |
tcgataacaacccaactcaacctcaaattttcttgcaaatattc |
27257796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University