View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20739_low_14 (Length: 255)
Name: NF20739_low_14
Description: NF20739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20739_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 114 - 240
Target Start/End: Complemental strand, 49299084 - 49298958
Alignment:
| Q |
114 |
aatgtaaccgtcgtcgttgtacggtgttgacgaccgagtgagattgcttctacgatttcctaatgcagcttttcgcattgcacttctcgctctagcaagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49299084 |
aatgtaaccgtcgtcgttgtacggtgttgacgaccgagtgagattgcttctacgatttcctaatgcagcttttcgcattgcacttctcgctccagcaagt |
49298985 |
T |
|
| Q |
214 |
ccttcttctcgcttcttttctctgctc |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
49298984 |
ccttcttctcgcttcttttctctgctc |
49298958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University