View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20739_low_16 (Length: 247)
Name: NF20739_low_16
Description: NF20739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20739_low_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 247
Target Start/End: Original strand, 36957815 - 36958049
Alignment:
| Q |
17 |
aggttttacatcatgcttattttactagcaaaatatgtgtacggatactagtgtagtgactctgctgctactcgacaattgatcaatgttgtttggcaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36957815 |
aggttttacatcatgcttattttactagcaaaatatgtgtacggatactagtgtagtgactctgctgctactcgacaattgatcaatgttgtttggcaac |
36957914 |
T |
 |
| Q |
117 |
accctgctattaattgcttc-aaaattaacgttgatggatcccatattgactctagtagcaaa---tatgttctaatggccactttgatagagaattttt |
212 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36957915 |
accctgctattaattgcttcaaaaattaacgttgatggatcccatattgactctagtagcaaatagtatgttctaatggccactttgatagagaattttt |
36958014 |
T |
 |
| Q |
213 |
atcataatttcaactattgcaatgtcgtgcgggct |
247 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36958015 |
atcataatttcgactattgcaatgtcgtgcgggct |
36958049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 87 - 179
Target Start/End: Complemental strand, 52338578 - 52338486
Alignment:
| Q |
87 |
ctcgacaattgatcaatgttgtttggcaacaccctgctattaattgcttcaaaattaacgttgatggatcccatattgactctagtagcaaat |
179 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| | | ||||||||||||||||||| |||| || |||||| |||| ||||| |||| |
|
|
| T |
52338578 |
ctcgacaattgatcaacgttgtttggcaaccccctattgtagattgcttcaaaattaacgtcgatgactcacatattaactccagtagaaaat |
52338486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University