View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20739_low_7 (Length: 480)
Name: NF20739_low_7
Description: NF20739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20739_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 281 - 471
Target Start/End: Complemental strand, 44451352 - 44451162
Alignment:
| Q |
281 |
ccaaccttctataaatattgcttagctaaactggaatttccagtgtgaaagaagatagttctcttttgtgtaattcttttgttgtgattgataaaacttc |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44451352 |
ccaaccttctataaatattgcttagctaaactggaatttccggtgtgaaagaagatagttctcttttgtgtaattcttttgttgtgatcgataaaacttc |
44451253 |
T |
 |
| Q |
381 |
aggggcgaataaatcccctttctgaccaagatcttaccagagatcctcctaacataatctttataaacagtgccattctgagtagaataat |
471 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44451252 |
aggggcgaataaatcccctttctggccaagatcttaccagagatcctcctaacataatctttataaacaatgccattctgagtagagtaat |
44451162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 44451633 - 44451444
Alignment:
| Q |
1 |
agttgcataagcctaagatgaaccaatagtcgagatcaaggttgttatcgaggtcggagatgcaccagcaaacacttgctgatttttaatgaatctcttc |
100 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44451633 |
agttgcagaagcctaagatgaaccaattgtcgagatcaaggttgttatcgaggtcggagatgcaccagcaaacacttactgatttttaatgaatctcttc |
44451534 |
T |
 |
| Q |
101 |
ctacagagaaggctctaaaggtttattactgaaagaaggggaa-aaaatataaatagagattaatatgtatttaggttcttttctacggg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44451533 |
ctacagagaaggctctaaaggtttattactgaaagaaggggaaaaaaatataaatagagattaatatgtatttaggttcttttttacggg |
44451444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University