View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2073_high_21 (Length: 244)
Name: NF2073_high_21
Description: NF2073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2073_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 53796163 - 53796372
Alignment:
| Q |
20 |
accagagactggagtaacttttgctgatgtggccggtgctgatcaagcgaaattggaactacaagaagttgttgatttcttgaagaatcctgataagtac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53796163 |
accagagactggagtaacttttgctgatgtggccggtgctgatcaagcgaaattggaactacaagaagttgttgatttcttgaagaatcctgataagtac |
53796262 |
T |
|
| Q |
120 |
actgctttaggcgctaagattcctaaaggatgtcttttagtggggccacctggaactggaaagacattgttggcgagggcagtggccggtgaagctggta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53796263 |
actgctttaggcgctaagattcctaaaggatgtcttttagtggggccacctggaactggaaagacattgttggcgagggcagtggccggtgaagctggta |
53796362 |
T |
|
| Q |
220 |
caccgttctt |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
53796363 |
caccgttctt |
53796372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University