View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2073_low_13 (Length: 295)
Name: NF2073_low_13
Description: NF2073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2073_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 70 - 281
Target Start/End: Original strand, 2544462 - 2544679
Alignment:
| Q |
70 |
aaattatatagcaactagcaaaagtcaagagatgatgaagtcgttattttgatctaagataaactttagtttgacatgttcttgttagaatttcctagca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2544462 |
aaattatatagcaactagcaaaagtcaagagatgatgaagtcgttattttgatctaagataaactttagtttgacatgttcttgttagaatttcctagca |
2544561 |
T |
 |
| Q |
170 |
ataaccaaacatacacaataataattgtataatatagtacatatgtactgat------actatagaatctcaaaccatattgaagaacactttgtatcac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2544562 |
ataaccaaacatacacaataataattgtataatatagtacatatgtactgatgtattaactatagaatctcaaaccatattgaagaacactttgtatcac |
2544661 |
T |
 |
| Q |
264 |
tctacactcaatgttgat |
281 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2544662 |
tctacactcaatgttgat |
2544679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 18 - 54
Target Start/End: Original strand, 2544409 - 2544445
Alignment:
| Q |
18 |
cattgttcattttggagtagttatttatcaaagatac |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2544409 |
cattgttcattttggagtagttatttatcaaagatac |
2544445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University