View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2073_low_17 (Length: 249)
Name: NF2073_low_17
Description: NF2073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2073_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 9669708 - 9669487
Alignment:
| Q |
1 |
ttttttacttcgtcctttctatttgattggcacccgtgaaatatttatccatgcttttgtcactcttatacttagcaacaaaggtttgaggtttgatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
9669708 |
ttttttacttcgtcctttctatttgattggcacccgtgaaatatttatccatgcttttatcactcttaaacctagcaacaaaggtttgaggtttgatctt |
9669609 |
T |
|
| Q |
101 |
gcnnnnnnngagtttgataagttggggaatagattaataagttttatctacaattgaatcgtcactctttggtagaataatctttggttacactttacct |
200 |
Q |
| |
|
|| |||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
9669608 |
gctttttttgagtttgataagttgggg---agattaataagttttatctacaattaaattgtcactctttggtagaataatcttt-gttacacgttacct |
9669513 |
T |
|
| Q |
201 |
tttggttgaacaccaaattagttaga |
226 |
Q |
| |
|
||||||||| ||| | |||||||||| |
|
|
| T |
9669512 |
tttggttgagcactagattagttaga |
9669487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University