View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2073_low_22 (Length: 206)
Name: NF2073_low_22
Description: NF2073
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2073_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 10 - 120
Target Start/End: Original strand, 32386209 - 32386319
Alignment:
| Q |
10 |
tcgaacaatattatatttacctagcgctgcaggcttcacgtagattttgacaggtcgcttagcgcctcaaacaaagattgggtgcatgtcacctattttc |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32386209 |
tcgatcaatattatatttacctagcgctgcaggcttcacgtaaattttgacgtgtcgcttagcgcctcaaacaaagattgggtgcatgtcacctattttc |
32386308 |
T |
 |
| Q |
110 |
aagcgctacgc |
120 |
Q |
| |
|
||||||||||| |
|
|
| T |
32386309 |
aagcgctacgc |
32386319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 189
Target Start/End: Original strand, 32386351 - 32386388
Alignment:
| Q |
152 |
gcatcatatacttgattttggatcttccaaagagtctc |
189 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32386351 |
gcatcatatacttgattttgggtcttccaaagagtctc |
32386388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University