View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20740_high_13 (Length: 272)
Name: NF20740_high_13
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20740_high_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 10 - 272
Target Start/End: Complemental strand, 15628889 - 15628627
Alignment:
| Q |
10 |
attatactcattccacattttgtaagtaaacaaatcctctattatcctctaccattcattaccttgcattgcaagcaattcccttagctgaattctctta |
109 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15628889 |
attatactcattccacattttgtcagtaaacaaatcctctattatcctctaccattcattaccttgcattgcaagcaattcccttagctgaattctctta |
15628790 |
T |
 |
| Q |
110 |
ttcatcatgccaacccttgttcaattcttgatactagttttactattgttcaattttgtgccagttttatcgcaagttaatcagttcttgtatgcaggat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
15628789 |
ttcatcatgccaacccttgttcaattcttgatactagttttactattgttcaattttgtgtcagttttatcccaagttaaccagttcttgtatgcaggat |
15628690 |
T |
 |
| Q |
210 |
tcaaggatgttggtcccaacaatctaaccttgaatggatttgcagagatagagaaaaatggga |
272 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15628689 |
tcaaggatgttggtcccaacaatcttaccttgaatggttttgcagagatagagaaaaatggga |
15628627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 91 - 139
Target Start/End: Original strand, 22932867 - 22932915
Alignment:
| Q |
91 |
ccttagctgaattctcttattcatcatgccaacccttgttcaattcttg |
139 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
22932867 |
ccttagctgatttctcttgttcatcatgccaacccatcttcaattcttg |
22932915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University