View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20740_high_16 (Length: 239)
Name: NF20740_high_16
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20740_high_16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 239
Target Start/End: Complemental strand, 18571562 - 18571339
Alignment:
| Q |
16 |
cagcacatgcaacagcaatggtttaagcagcttccacaacaatgtgtggctgctttaacaaacatttcagcactatcattcaagcttggttcatcacctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18571562 |
cagcacatgcaacagcaatggtttaagcagcttccacaacaatgtgtggctgctttaacaaacatttcagcactatcattcaagcttggttcatcacctc |
18571463 |
T |
|
| Q |
116 |
ctggtggtgtgttctcagcagttgcagccaagttgccaaagcctatgcctaattttggtagcaaaagtgttctatggccttggtctttttcacctttctt |
215 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||||||| ||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18571462 |
ctggtggagtgttctcagcagtagcagctaagttgccaaaacctatacctagttttggtagcaaaagtgttctctggccttggtctttttcacctttctt |
18571363 |
T |
|
| Q |
216 |
ttttgatgccttttcgccatgatt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18571362 |
ttttgatgccttttcgccatgatt |
18571339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University