View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20740_high_20 (Length: 204)
Name: NF20740_high_20
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20740_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 2 - 184
Target Start/End: Complemental strand, 40430637 - 40430449
Alignment:
| Q |
2 |
atttataatctcttataaaccatgcaatgcaactgcaattaattaattcttcaatcttctcattttccatttccatttccatttc------aaaccaaaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40430637 |
atttataatctcttataaaccatgcaatgcaactgcaattaattaattcttcaatcttctcattttccatttccatttccatttccatttcaaaccaaaa |
40430538 |
T |
 |
| Q |
96 |
aaccctaacaaacatggctgatacaggaggacactaccaacctcttcgtggctacaaccaacaacacagcactaccactcaacaacagc |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40430537 |
aaccctaacaaacatggctgatacaggaggacactaccaacctctccgtggctacaaccaacaacacagcactaccactcaacaacagc |
40430449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University