View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20740_low_12 (Length: 292)
Name: NF20740_low_12
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20740_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-150; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 15628638 - 15628363
Alignment:
| Q |
1 |
agaaaaatgggatgataagattaacaaatcacacaaacaatgaaatgggccatgctttttacacattaccttttcagctaaggaactcgacaactcgtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15628638 |
agaaaaatgggatgataagattaacaaatcacacaaacaatgaaatgggccatgctttttactcattaccttttcagctaaggaactcgacaactcgtaa |
15628539 |
T |
 |
| Q |
101 |
agcttactcattttcttcatcttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttcacaatagcaactactaaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15628538 |
agcttactcattttcttcatcttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttcacaatagcaactactaaggat |
15628439 |
T |
 |
| Q |
201 |
ctcgaaggttcgcctcttcagtatcttggtcttttcaattcgagtaatgttggtaatatttcgaaccatctttttg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15628438 |
ctcgaaggttcgcctcttcagtatcttggtcttttcaattcgagtaatgttggtaatttttcgaaccatctttttg |
15628363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 121 - 203
Target Start/End: Original strand, 17393994 - 17394076
Alignment:
| Q |
121 |
cttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttcacaatagcaactactaaggatctc |
203 |
Q |
| |
|
||||||||| || ||||| |||||||| | ||| ||||||||||||| ||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
17393994 |
cttttgctcatgatgttgcccctgagtgttgtaaagtaggtggtcatggtatgactttcactatagcaactacaaaggatctc |
17394076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 22933034 - 22933272
Alignment:
| Q |
1 |
agaaaaatgggatgataagattaacaaatcacacaaacaatgaaatgggccatgctttttacacattaccttttcagctaaggaactcgacaactcgtaa |
100 |
Q |
| |
|
|||||||||| || ||||||||||||||| | ||| ||| ||||||||||||||||||| | |||||||||||||| |||||| |||||| |||| |
|
|
| T |
22933034 |
agaaaaatggaataataagattaacaaatgattcaagcaaattaatgggccatgctttttactctcaaccttttcagctaaagaactcaacaactggtaa |
22933133 |
T |
 |
| Q |
101 |
agcttactcattttcttcatcttttgctcttgctgttgtccctgagtatcctaatataggtggtcatggcatggctttcacaatagcaactactaaggat |
200 |
Q |
| |
|
||||| || ||||| ||| | |||||| |||||||||| ||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22933134 |
agctttttccttttcatcaacctttgctattgctgttgttcctgagtatcctagagttggtggtcatggcatggctttcacaatagcacctactaaggat |
22933233 |
T |
 |
| Q |
201 |
ctcgaaggttcgcctcttcagtatcttggtcttttcaat |
239 |
Q |
| |
|
||| | | || ||| |||| |||||||||||||||||| |
|
|
| T |
22933234 |
ctcaatgctttacctattcaatatcttggtcttttcaat |
22933272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University