View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20740_low_19 (Length: 208)
Name: NF20740_low_19
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20740_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 98 - 168
Target Start/End: Complemental strand, 18823360 - 18823290
Alignment:
| Q |
98 |
tcctttcgaaattagaaaaccctaaagtcctaattcattcaaaaagcaattcacaaccatcgatcttcttg |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18823360 |
tcctttcgaaattagaaaaccctaaagtcctaattcattcaaaaagcaattcacaaccatcgatcttcttg |
18823290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 18823702 - 18823621
Alignment:
| Q |
18 |
gcaacaagctaaattcatcaaggaggtttttatagttnnnnnnnttaagaggttttctagttaaatattttcgttttaaatc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18823702 |
gcaacaagctaaattcatcaaggaggtttttatagttaaaaaaattaagaggttttctagttaaatattttcgttttaaatc |
18823621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University