View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20740_low_19 (Length: 208)

Name: NF20740_low_19
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20740_low_19
NF20740_low_19
[»] chr7 (2 HSPs)
chr7 (98-168)||(18823290-18823360)
chr7 (18-99)||(18823621-18823702)


Alignment Details
Target: chr7 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 98 - 168
Target Start/End: Complemental strand, 18823360 - 18823290
Alignment:
98 tcctttcgaaattagaaaaccctaaagtcctaattcattcaaaaagcaattcacaaccatcgatcttcttg 168  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18823360 tcctttcgaaattagaaaaccctaaagtcctaattcattcaaaaagcaattcacaaccatcgatcttcttg 18823290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 18823702 - 18823621
Alignment:
18 gcaacaagctaaattcatcaaggaggtttttatagttnnnnnnnttaagaggttttctagttaaatattttcgttttaaatc 99  Q
    |||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
18823702 gcaacaagctaaattcatcaaggaggtttttatagttaaaaaaattaagaggttttctagttaaatattttcgttttaaatc 18823621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University