View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20740_low_9 (Length: 338)
Name: NF20740_low_9
Description: NF20740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20740_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 312
Target Start/End: Original strand, 37527674 - 37527985
Alignment:
| Q |
1 |
ctttgttgtctcttactctctgcaaccacagcacaattacaacttcgacctagtttaaatgccaatcaaaacacatgttactcttggattattaaggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37527674 |
ctttgttgtctcttactctctgcaaccacaacacaattacaacttcgacctagtttaaatgccaatcaaaacacatgttactcttggattattaaggcat |
37527773 |
T |
 |
| Q |
101 |
gaatattcaagattccatgacttatgtctagttaagctttcatagttcgttacgaaaaattttcgcaacttggtttatccgtccacggcaaagagggcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37527774 |
gaatattcaagattccatgacttatgtctagttaagctttcatagttcgttacgaaaaattttcgcaacttggtttatccgtccacggcaaagagggcaa |
37527873 |
T |
 |
| Q |
201 |
atttttaagcgcgaggagcaagttgtacagcaacacatatgcccgcacctgaaatttaaagatagaccttagggattatgaattatattcacataaagag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37527874 |
ttttttaagcgcgaggagcaagttgtacagcaacacatatgcccgcacctgaaatttaaagatagaccttagggattatgaattgtattcacataaagag |
37527973 |
T |
 |
| Q |
301 |
attgttttaaga |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37527974 |
attgttttaaga |
37527985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University