View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20742_high_2 (Length: 392)
Name: NF20742_high_2
Description: NF20742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20742_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 22 - 182
Target Start/End: Original strand, 33152583 - 33152743
Alignment:
| Q |
22 |
catcatcatcgtcatcttcttcttcaaccgccatctcctcttcaccggtctctccattgtcatcttcatctccatcttcctccccttgctcgtgcccatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33152583 |
catcatcatcgtcatcttcttcttcaaccgccatctcctcttcaccggtctctccattgtcatcttcatctccatcttcctccccttgctcatgcccatc |
33152682 |
T |
|
| Q |
122 |
gatctcaccttcagcactcaccaaccgcccagaagtactctcaggctcagcaaaatcccct |
182 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33152683 |
gatctcaccttcagtactcaccaaccgcccagaagtactctcaggctcagcaaaatcccct |
33152743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University