View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20742_low_2 (Length: 261)
Name: NF20742_low_2
Description: NF20742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20742_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 218
Target Start/End: Complemental strand, 23332800 - 23332595
Alignment:
| Q |
13 |
tgagatgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacttatgtacagccgaatcttctagatatgactatcgcagagagatcagga |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332800 |
tgagctgaagggtttctataaggtagatcgtggtgcgtgggtcaccctgacgtatgtacagccgaatcttctagatatgactatcgcagagagatcagga |
23332701 |
T |
 |
| Q |
113 |
gtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtccaacgtgagggtggatcggtcatgcgcttctatcgctcattcgtcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332700 |
gtcgaaatcaactatcctaacaaatttcttcctcccatgtcgaaaatgattgtcccacgtgagggtggatcggtcatgcgcttctatcgctcattcgtcc |
23332601 |
T |
 |
| Q |
213 |
acatat |
218 |
Q |
| |
|
| |||| |
|
|
| T |
23332600 |
atatat |
23332595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 255
Target Start/End: Complemental strand, 23322373 - 23322331
Alignment:
| Q |
213 |
acatatgcgtttggattttacaacgattgtgtttgatgatgtc |
255 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
23322373 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23322331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 255
Target Start/End: Complemental strand, 23332540 - 23332498
Alignment:
| Q |
213 |
acatatgcgtttggattttacaacgattgtgtttgatgatgtc |
255 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
23332540 |
acatatgcgtttggagtttacaacgtttgtgtttggtgatgtc |
23332498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University