View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20743_high_4 (Length: 346)
Name: NF20743_high_4
Description: NF20743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20743_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 16 - 333
Target Start/End: Complemental strand, 50373312 - 50372995
Alignment:
| Q |
16 |
gaatgtgtacgactggattttctattaaactatctattaggcgctagttagcaagcacacatagtattaggttggattgaagtgtttagcttccactaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50373312 |
gaatgtgtacgactggattttctattaaactatctattaggcgctagttggcaagcacacatagtattaggttggattgaagtgtttagcttccactaac |
50373213 |
T |
|
| Q |
116 |
tttctaaaatgtatagatgaccgtaaaaagtagaattagtgtgcagttaagctgttttctctcatcattctgcaaattggattgtggctctcatcattct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50373212 |
tttctaaaatgtatagatgaccgtaaaaagtagaattagtgtgcagttaagctgttttctctcatcattctgcaaattggattgtggctctcatcattct |
50373113 |
T |
|
| Q |
216 |
cacgtttactttgtttctttggaacaagaggtttagctttgaaaatcaccaccccaggggttctgctttatctgttttctttgattacgctttatgaagc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
50373112 |
aacgtttactttgtttctttggaacaagaggtttagctttgaaaatcaccaccccaggggttctgctttaaccgttttctttgattacgctttatgaagc |
50373013 |
T |
|
| Q |
316 |
tgttacttttgctgattc |
333 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
50373012 |
tgttacttttgctgattc |
50372995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 98 - 136
Target Start/End: Original strand, 48272529 - 48272567
Alignment:
| Q |
98 |
tgtttagcttccactaactttctaaaatgtatagatgac |
136 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48272529 |
tgtttagcttgcactaactttctaaaatgtatagatgac |
48272567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University