View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20744_high_14 (Length: 246)
Name: NF20744_high_14
Description: NF20744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20744_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 555069 - 555304
Alignment:
| Q |
1 |
ccttcatttgggatggtaatgcattatttgaatataaaata---caagagaatagccctttattgggttaatctatagatacatgaaatcctattata-- |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
555069 |
ccttcatttgggatggtaatgcattatttgaatataaaatagtacaagagaatagccctttattgggttagtctatagatacatgaaatcctattatata |
555168 |
T |
 |
| Q |
96 |
--atcactatgtatatcctattttttggtgttatgatatttcactctccactctaacatgattcctttttgaa-ttgtagatctacaactccaatacaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
555169 |
taatcactatgtatatcctattttttggtgttatgatatttcactctccactctaacatgattcctttttgaatttgtagatctacaactccaatacaaa |
555268 |
T |
 |
| Q |
193 |
gacatgaagtttctttatggtagttgcacaatggtg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
555269 |
gacatgaagtttctttatggtagttgcacaatggtg |
555304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 130 - 176
Target Start/End: Original strand, 22023959 - 22024005
Alignment:
| Q |
130 |
tatttcactctccactctaacatgattcctttttgaattgtagatct |
176 |
Q |
| |
|
|||||||||||||| ||||||| || ||| ||||||||||||||||| |
|
|
| T |
22023959 |
tatttcactctccaatctaacaagagtccattttgaattgtagatct |
22024005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University