View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20744_low_11 (Length: 339)
Name: NF20744_low_11
Description: NF20744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20744_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 31455132 - 31455454
Alignment:
| Q |
1 |
gttacacttttagatgcatgtagttcatcaagggaattactcttgaatctcaaggaacatgtggaaacacttcaatccgctatacgtagaagacgaggaa |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31455132 |
gttacacttttagatgcatgtggttcatcaagggaattactcttgaatctcaaggaacatgtggaaacacttcaatcggctatacgtagaagacgaggaa |
31455231 |
T |
|
| Q |
101 |
attcaacttcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttctaagcaacttagtgaaatgaagaaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
31455232 |
attcaacttcaagcattgaaagcagcatatatgagtatgattgctttagaaagaaggcaaagaaggaaatttcaaagcaacttggtgaaatgaagaaaat |
31455331 |
T |
|
| Q |
201 |
ggaaaacaaagtaaagcttttttctattatgggacaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455332 |
ggaaaacaaagtaaagcttttttctattatgggccaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctata |
31455431 |
T |
|
| Q |
301 |
tttcgttctcttttactattcat |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31455432 |
tttcgttctcttttactattcat |
31455454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University