View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20744_low_19 (Length: 227)
Name: NF20744_low_19
Description: NF20744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20744_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 36255981 - 36255790
Alignment:
| Q |
1 |
tggattcaagtatcttcttgcatacttggtctctgaaggagaatgaatatcctgaacttattgatgagcttttggagttgacagtgtataactttgagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36255981 |
tggattcaagtatcttcttgcatacttggtctctgaaggagaatgaatatcctgaacttattgatgagcttttggagttgacagtgtataactttgagaa |
36255882 |
T |
|
| Q |
101 |
gctgcataaggcaactagcttttttggtgaagctaagacaataaagggctcttcggtttaccgagcatgcttgaagggtaatgcttctgcag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36255881 |
gctgcataaggcaactagcttttttggtgaagctaagacaataaagggctcttcggtttaccgagcatgcttgaagggtaatgcttctgcag |
36255790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 78 - 192
Target Start/End: Complemental strand, 36263207 - 36263093
Alignment:
| Q |
78 |
ttgacagtgtataactttgagaagctgcataaggcaactagcttttttggtgaagctaagacaataaagggctcttcggtttaccgagcatgcttgaagg |
177 |
Q |
| |
|
|||||||||||| | |||||| |||||||||| ||||| |||||||| |||||||||| | |||| ||| ||||| | |||||||||| ||||||||| |
|
|
| T |
36263207 |
ttgacagtgtatgaatttgaggagctgcataaagcaacgagctttttcagtgaagctaacaggataaggggttcttcagcttaccgagcaagcttgaagg |
36263108 |
T |
|
| Q |
178 |
gtaatgcttctgcag |
192 |
Q |
| |
|
|| ||| | |||||| |
|
|
| T |
36263107 |
gtgatgatgctgcag |
36263093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 36263691 - 36263623
Alignment:
| Q |
1 |
tggattcaagtatcttcttgcatacttggtctctgaaggagaatgaatatcctgaacttattgatgagctttt |
73 |
Q |
| |
|
||||||||||||| ||||| ||||| ||||||| |||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
36263691 |
tggattcaagtatattcttacatacctggtctccgaagga----gaatatcctgaacttattgctgagatttt |
36263623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University