View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20745_low_12 (Length: 215)
Name: NF20745_low_12
Description: NF20745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20745_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 12736642 - 12736461
Alignment:
| Q |
21 |
ggcgatcccattagtgatcatgattgttgggaaaggccagaagacatggacacttctaggacaacctattatttgtccgcgacgagacctggttcggagg |
120 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12736642 |
ggcgatcccattagtgaccatgattgttgggaaagaccagaagacatggacacttctaggacaacctattatttgtccgcgacaagacctggttcggagg |
12736543 |
T |
 |
| Q |
121 |
tttcagccgagattgcagccgggcttgcggcatcatccattgcattcagaaacattgatcctggatattctagtattcttct |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
12736542 |
tttcagccgagattgcagccgcgcttgcggcgtcatccattgctttcagaaacattaatcgtggatattctaggattcttct |
12736461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 30 - 179
Target Start/End: Complemental strand, 12765924 - 12765775
Alignment:
| Q |
30 |
attagtgatcatgattgttgggaaaggccagaagacatggacacttctaggacaacctattatttgtccgcgacgagacctggttcggaggtttcagccg |
129 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||| | || || ||||||||||||||||||| |
|
|
| T |
12765924 |
attagtgaccatgattgttgggaaagaccagaagacatggacacttctagaacaacctattatgtgtccgaaaataggccaggttcggaggtttcagccg |
12765825 |
T |
 |
| Q |
130 |
agattgcagccgggcttgcggcatcatccattgcattcagaaacattgat |
179 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
12765824 |
agattgcggccgcacttgcggcgtcatccattgcatttagaaaaattgat |
12765775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University