View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20745_low_7 (Length: 283)
Name: NF20745_low_7
Description: NF20745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20745_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 25361998 - 25362270
Alignment:
| Q |
1 |
cttaccctctttttaggtacagctgttgtaagctgttgtattgcccgatgttctttgttattgtgttttactacgacttttgcaacccggttagacttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25361998 |
cttaccctctttttaggtacagctgttggaagctgttgtattgcccgttgttctttgttattgtgttttactacgacttttgcaacccgcttagacttga |
25362097 |
T |
|
| Q |
101 |
aaatcttgttagcgaacaatcttccacaagtatgctccgggcagagtgtcccgaccctaaatgtggtaggccttaccactctattcacaaaaatagtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25362098 |
aaatcttgttagcgaacaatcttccacaggtatgctccgggcagagtgtcccgaccctaaatgtggtaggccttaccactctactcacaaaaatagtgta |
25362197 |
T |
|
| Q |
201 |
tccacattttttgtttaacttacaaacagctctaaccttccatttgtcgttctcggcaaattttatctctctg |
273 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
25362198 |
tccacattttttgttaaacttacaaacagctctaaccttccatttgtcgttctcggtaaattttatctctctg |
25362270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 197 - 266
Target Start/End: Original strand, 25352842 - 25352911
Alignment:
| Q |
197 |
tgtatccacattttttgtttaacttacaaacagctctaaccttccatttgtcgttctcggcaaattttat |
266 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| ||||| ||| ||| || ||| |||||||||||| |
|
|
| T |
25352842 |
tgtatccacatttttggttgaacttacaaacagctttaaccctccttttctcaatcttggcaaattttat |
25352911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University