View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20745_low_8 (Length: 255)
Name: NF20745_low_8
Description: NF20745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20745_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 45179026 - 45179275
Alignment:
| Q |
1 |
aacagtaaattgcaattgtgtgtgtgcgcgcgcacgtgtttacacacactatgttttatgaatttataaatattatgtatcctatcttatatttgnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45179026 |
aacagtaaattgcaattgtgtgtgtccgcgcgcacgtgtttacacacactatgttttatgaatttataaatattatgtatcctatcttatatttgaaaaa |
45179125 |
T |
 |
| Q |
101 |
nntaatcatcgctatatcatattcatatccagattctggtaacacatttgtgcacaacacaatattgcaactaactttcggatatacttaatatttcata |
200 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45179126 |
aataatcatccctaaatcatattcatatccagattctggtaacacatttgtgcacaacacaatattgcaactaac-ttcggatatacttaatatttcata |
45179224 |
T |
 |
| Q |
201 |
acttaagctaagaactactcacttgacactggatctttacttcttctcact |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45179225 |
acttaagctaagaactactcacttgacactggatctttacttcttttcact |
45179275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University