View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20747_low_6 (Length: 396)
Name: NF20747_low_6
Description: NF20747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20747_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 2 - 385
Target Start/End: Original strand, 37296850 - 37297219
Alignment:
| Q |
2 |
caggatgaccgatgacctctcatgctcttctccacatatgtgtgtaataaccctcttcagtaatttaaggattcgtttgcaggtggatttatttaacttg |
101 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37296850 |
caggatgagcgatgacctctcatgctcttctccacatatgtgtgtaataaccctcttcagtaatttaaggattcgtttgcaggtggatttatttaacttg |
37296949 |
T |
 |
| Q |
102 |
gaatcatcaagaactggtagtagaggtacagtcttgtccacaagcctcttgtggcnnnnnnnnnnnnggcttaaggtacaagaaaggagggagattcatg |
201 |
Q |
| |
|
|||| ||||||||| |||||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||| || |
|
|
| T |
37296950 |
gaattatcaagaaccggtagtagagctacagtcttgtccacaagcctattgtggctttttttt----ggcttaaggtacaagaaagga----------tg |
37297035 |
T |
 |
| Q |
202 |
tattgaaaggataggcagggtctcaaatggtgcaatcaggacgtcccatgatccctatgcagctatgcctcaacgctttctttttaatttaccattgcat |
301 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37297036 |
tattgaaaggataggcagggtctcaaacggtgcaatcaggacgtcccatgatccatatgcagctatgcctcaacgctttccttttaatttaccattgcat |
37297135 |
T |
 |
| Q |
302 |
ggacaatgtaaattatgtttaattgatgtctttactagatttagacccctacattgatattgggccgaataactgatgatgatg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37297136 |
ggacaatgtaaattatgtttaattgatgtctttgctagatttagaccgctacattgatattgggccgaataactgattatgatg |
37297219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University