View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20748_high_15 (Length: 255)
Name: NF20748_high_15
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20748_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 10 - 209
Target Start/End: Complemental strand, 32509966 - 32509769
Alignment:
| Q |
10 |
attattctttcacaatatcaaatgttgacaaagattaaccttttaaatgaatctcaatgtcttaagggttaatctgcagttttcggtagggagacaccta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32509966 |
attattctttcacaatatcaaatgttgacaaagattaaccttttaaatgaatctcaatgtcttaagggttaatctgcagttttcggtagggagagacc-- |
32509869 |
T |
 |
| Q |
110 |
gttgtcttgatgnnnnnnngtgattctttttacaatatagtcaaacaaagtttataaaaattttggcgaaaccttttttgacacaatgagcttgttgcaa |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32509868 |
gttgtcttgatgttttttcacaattctttttacaatataatcaaacaaagtttataaaaattatggcgaaacctttgttgacacaatgagcttgttgcaa |
32509769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 10 - 47
Target Start/End: Complemental strand, 32512839 - 32512802
Alignment:
| Q |
10 |
attattctttcacaatatcaaatgttgacaaagattaa |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32512839 |
attattctttcacaatatcaaatggtgacaaagattaa |
32512802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University