View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20748_high_16 (Length: 244)
Name: NF20748_high_16
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20748_high_16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 22653708 - 22653947
Alignment:
| Q |
5 |
gagaagcaaaggagagagacccgagattcatacccattaacccggttgtgttaaaatctccatcagagtttgtgctaatgcttgagtccatacacccaaa |
104 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653708 |
gagaaacaaaagagagagacccgagattcatacccattaacccggttgtgttaaaatctccatcagagtttgtgctaatgcttgagtccatacacccaaa |
22653807 |
T |
|
| Q |
105 |
tacaattcccgggttatcggatcctccaaacccgaatgaatcagaagcaaggttcccttcagaggaagaaaaatctgcgtatgaaagagttgcatggcaa |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22653808 |
tacaattcccgggttatcggatgctccaaacccgaatgaatcagaagcaaggttcccttcagaggaagaaaaatctgcgtatgaaagagttgcatggcaa |
22653907 |
T |
|
| Q |
205 |
tgattgttggagtcacatgaagcaggtatgggaaaatctc |
244 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22653908 |
tgattgttggagtcgcatgaagcaggtatgggaaaatctc |
22653947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University