View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20748_high_9 (Length: 330)
Name: NF20748_high_9
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20748_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 308
Target Start/End: Original strand, 44681727 - 44682020
Alignment:
| Q |
18 |
aagtgtttatatgaaatgatttgaatttcttgcatgataaaattatcatcctcatactttgcaatttttattc----tgtgttgataatgttttgaaaca |
113 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||||||| |||| ||||||||||| |||| | | | |||| |||| ||||| | |||| || || |
|
|
| T |
44681727 |
aagtgtttattcggaatgatttgaaattcttgcatgatacaattctcatcctcataatttgtattctgtattgatgatgtgctgata-tattttcaagca |
44681825 |
T |
|
| Q |
114 |
ttgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaaggtgctt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44681826 |
ttgcagtgaaaagaaaatggggaatcttgtgtgttgtgtgcaagttgatcaatctcaagtggctatgaaagaaggttttggaaaatttgaaaaggtgctt |
44681925 |
T |
|
| Q |
214 |
cagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattggatatcaaatgtgagac |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
44681926 |
cagccgggatgccattgcatgccatggttccttggaaaacgaattgctggtcatctctctcttcgggtacaacaattggatatcaagtgtgagac |
44682020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 104 - 309
Target Start/End: Original strand, 44652802 - 44653007
Alignment:
| Q |
104 |
ttttgaaacattgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttga |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44652802 |
ttttgaagcattgcagtgaaaagaaaatggggaatcttgtgtgttgtgtgcaagttgatcaatctcaagtggctatgaaagaaggttttggaaaatttga |
44652901 |
T |
|
| Q |
204 |
aaaggtgcttcagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattggatatcaaatgt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44652902 |
aaaggtgcttcagccgggatgccattgcatgccatggttccttggaaaaagaattgctggtcatctctctcttcgggtacaacaattggatatcaaatgt |
44653001 |
T |
|
| Q |
304 |
gagacc |
309 |
Q |
| |
|
|||||| |
|
|
| T |
44653002 |
gagacc |
44653007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 116 - 309
Target Start/End: Original strand, 44691502 - 44691695
Alignment:
| Q |
116 |
gcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaaggtgcttca |
215 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44691502 |
gcagtgaaaagaaaatggggaatattgtgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaaggtgcttca |
44691601 |
T |
|
| Q |
216 |
gccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattggatatcaaatgtgagacc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
44691602 |
tccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcgggttcaacaattggatatcaaatgtgagacc |
44691695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 104 - 309
Target Start/End: Complemental strand, 44637528 - 44637323
Alignment:
| Q |
104 |
ttttgaaacattgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttga |
203 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
44637528 |
ttttgaaatgttgcagttaaaagaaaatggggaatcttttgtgttgtgtgcaagttgatcaatctacagtggctatgaaagagggttttggaaaatttga |
44637429 |
T |
|
| Q |
204 |
aaaggtgcttcagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattggatatcaaatgt |
303 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
44637428 |
agaggtgcttcagccaggatgccattgcatgccatggttccttggaaaacgaattgctggtcatctctctcttcggctacagcaattggatataaaatgt |
44637329 |
T |
|
| Q |
304 |
gagacc |
309 |
Q |
| |
|
|||||| |
|
|
| T |
44637328 |
gagacc |
44637323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 109 - 309
Target Start/End: Original strand, 44631319 - 44631519
Alignment:
| Q |
109 |
aaacattgcagtgaaaagaaaatggggaatcttatgtgttgcgtgcaagttgatcaatctcaagtggctatgaaagaaggttttgggaaatttgaaaagg |
208 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||||||||||||||| ||| |||||||||| |||||||||||| ||||||||| ||| |
|
|
| T |
44631319 |
aaacattgcagttaaaagcaaatggggaatcttttgtgttgcgtgcaagttgatcagtctacggtggctatgagagaaggttttggaaaatttgaagagg |
44631418 |
T |
|
| Q |
209 |
tgcttcagccgggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctctcttcggctacaacaattggatatcaaatgtgagac |
308 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44631419 |
tgcttcagccaggatgccattgcatgccatggttccttggaaaacgaattgccggtcatctctcccttcggctacaacaattggatataaaatgtgagac |
44631518 |
T |
|
| Q |
309 |
c |
309 |
Q |
| |
|
| |
|
|
| T |
44631519 |
c |
44631519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University