View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20748_low_13 (Length: 293)
Name: NF20748_low_13
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20748_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 46404948 - 46404853
Alignment:
| Q |
1 |
gtcccctttgattgagaaaagaattcgtagaacagttaaatagacattgtcatagcggtttcattgggtatggactgagcggagtacagactgatg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46404948 |
gtcccctttgattgagaaaagaattcgtagaacagttagatagacattgtcatagcggtttcattgggtatggactgagcggagtacagactgatg |
46404853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 92 - 173
Target Start/End: Original strand, 46404979 - 46405060
Alignment:
| Q |
92 |
tgatgtaattctaactgcttttataacttaacgcgaaaagtgagagaatttgaagcagtagctttatgcactactagcagtt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46404979 |
tgatgtaattctaactgcttttataacttgacgcgaaaagtgagagaatttgaagcagtagatttatgcactactagcagtt |
46405060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University