View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20748_low_13 (Length: 293)

Name: NF20748_low_13
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20748_low_13
NF20748_low_13
[»] chr3 (2 HSPs)
chr3 (1-96)||(46404853-46404948)
chr3 (92-173)||(46404979-46405060)


Alignment Details
Target: chr3 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 46404948 - 46404853
Alignment:
1 gtcccctttgattgagaaaagaattcgtagaacagttaaatagacattgtcatagcggtttcattgggtatggactgagcggagtacagactgatg 96  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46404948 gtcccctttgattgagaaaagaattcgtagaacagttagatagacattgtcatagcggtttcattgggtatggactgagcggagtacagactgatg 46404853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 92 - 173
Target Start/End: Original strand, 46404979 - 46405060
Alignment:
92 tgatgtaattctaactgcttttataacttaacgcgaaaagtgagagaatttgaagcagtagctttatgcactactagcagtt 173  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
46404979 tgatgtaattctaactgcttttataacttgacgcgaaaagtgagagaatttgaagcagtagatttatgcactactagcagtt 46405060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University