View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20748_low_16 (Length: 255)

Name: NF20748_low_16
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20748_low_16
NF20748_low_16
[»] chr3 (1 HSPs)
chr3 (1-135)||(46404924-46405060)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 46404924 - 46405060
Alignment:
1 aattcttttctcaatcaaaggggacatttgtgaaacgtgagggaatgaga--gattgatgtaattctaactgcttttataacttaacgcgaaaagtgaga 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||| |||||||||||||||    
46404924 aattcttttctcaatcaaaggggacatttgtgaaacgtgagggaatgagagagattgatgtaattctaactgcttttataacttgacgcgaaaagtgaga 46405023  T
99 gaatttgaagcagtagctttatgcactactagcagtt 135  Q
    |||||||||||||||| ||||||||||||||||||||    
46405024 gaatttgaagcagtagatttatgcactactagcagtt 46405060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University