View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20748_low_16 (Length: 255)
Name: NF20748_low_16
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20748_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 46404924 - 46405060
Alignment:
| Q |
1 |
aattcttttctcaatcaaaggggacatttgtgaaacgtgagggaatgaga--gattgatgtaattctaactgcttttataacttaacgcgaaaagtgaga |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
46404924 |
aattcttttctcaatcaaaggggacatttgtgaaacgtgagggaatgagagagattgatgtaattctaactgcttttataacttgacgcgaaaagtgaga |
46405023 |
T |
 |
| Q |
99 |
gaatttgaagcagtagctttatgcactactagcagtt |
135 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46405024 |
gaatttgaagcagtagatttatgcactactagcagtt |
46405060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University