View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20748_low_4 (Length: 465)
Name: NF20748_low_4
Description: NF20748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20748_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 1 - 451
Target Start/End: Complemental strand, 2528974 - 2528530
Alignment:
| Q |
1 |
ttttcttgtgtttcaacaatgtcacaaaattggttgcatgaatatttcaaatgggtcttctttcttttttcatcaacttttctaaaaatttgnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528974 |
ttttcttgtgtttcaacaatgtcacaaaattggttgcatgaatatttcaaatgggtcttctttcttttttcatcaacttttctaaaaatttgtttttttt |
2528875 |
T |
|
| Q |
101 |
nnnggaattctgggattgctttgttatannnnnnnnnnncctttgttcaaatcaaaggggttttggtgtagaaatttcaaagggtcttttgtggtttttg |
200 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528874 |
ttt--aattctgggattgctttgttatattttttt----cccttgttcaaatcaaaggggttttggtgtagaaatttcaaagggtcttttgtggtttttg |
2528781 |
T |
|
| Q |
201 |
aatgtagggtttaggatttcacaattggaattcagttgagatttgtgagtgtctttgagcctgcatgcaagggatcagttttctgaattttgcttttgta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528780 |
aatgtagggtttaggatttcacaattggaattcagttgagatttgtgagtgtctctgagcctgcatgcaagggatcagttttctgaattttgcttttgta |
2528681 |
T |
|
| Q |
301 |
tgtatatgcagagaaatggaagaattttgttaatttctctatgagaaacatgatgatttttaatttcataaatattttaccagcttgattgaatgaattt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2528680 |
tgtatatgcagagaaatggaagaattttgttaatttctctatgagaaacatgatgatttttaatttcataaatattttaccagcttgattgaatcaattt |
2528581 |
T |
|
| Q |
401 |
tttgtctgacatgtttgttttgtttcattttcctgtctgatttgttctctg |
451 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2528580 |
tttgtctgacatgtttgttttgtttcattttcctgtctgatttgttctctg |
2528530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University