View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20749_low_10 (Length: 215)

Name: NF20749_low_10
Description: NF20749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20749_low_10
NF20749_low_10
[»] chr5 (1 HSPs)
chr5 (18-198)||(41547401-41547581)


Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 41547581 - 41547401
Alignment:
18 gaaacagtaaacaagaatttggcaactataagagaattgaggaacgaaaatagcaaattagcaaatgataagcacaatgttgacatattactagcgtctt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41547581 gaaacagtaaacaagaatttggcaactataagagaattgaggaacgaaaatagcaaattagcaaatgataagcacaatgttgacatattactagcgtctt 41547482  T
118 ggatcacgaagtttagagtcttgcatgaaaaagtttcaaggctggaggatgattccaaactattgatgagcttaaatgtct 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41547481 ggatcacgaagtttagagtcttgcatgaaaaagtttcaaggctggaggatgattccaaactattgatgagcttaaatgtct 41547401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University