View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20750_low_10 (Length: 240)
Name: NF20750_low_10
Description: NF20750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20750_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 7969726 - 7969502
Alignment:
| Q |
1 |
tgcaatcaaaatgagctaatgaaacttctgagaaacaaaagtttgtgacaatgccaaataataaaaaagaggg--ttgagaatagagatgcgatggtttc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7969726 |
tgcaatcaaaatgagctaatgaaacttctgagaaacaaaagtttgtgacaatgccaaataataaaaaagagggttttgagaatagagatgcgatggtttc |
7969627 |
T |
|
| Q |
99 |
taaatgatatgcattggtgatgataatgatgacaacgatgtttgatgnnnnnnntgtgtcttttggtctttcatatttttggcaattagtatatgttatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7969626 |
taaatgatatgcattggtgatgataatgatgacaacgatgtttgatgaaaaaaatgtgtcttttggtctttcatatttttggcaattagtatatgttatt |
7969527 |
T |
|
| Q |
199 |
gtccttttcctttatggttcggaca |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
7969526 |
gtccttttcctttatggttcggaca |
7969502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University