View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20751_high_2 (Length: 246)

Name: NF20751_high_2
Description: NF20751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20751_high_2
NF20751_high_2
[»] chr3 (1 HSPs)
chr3 (15-59)||(50610689-50610733)


Alignment Details
Target: chr3 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 15 - 59
Target Start/End: Complemental strand, 50610733 - 50610689
Alignment:
15 atcatgtaacaattgtaagttagagttcgatcaagagtgaaaata 59  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
50610733 atcatgtaacaattgtaagttagagttcgatcaagagtgaaaata 50610689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University