View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20751_high_3 (Length: 234)
Name: NF20751_high_3
Description: NF20751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20751_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 27 - 217
Target Start/End: Original strand, 38571621 - 38571811
Alignment:
| Q |
27 |
aaaaaatgacactgatcattagaaactcgcacacatatgagtggagcagccggaactcaaactcaattacagcattcaacctaacaattatagctttttt |
126 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
38571621 |
aaaaaatgacactagtcattagaaactcgcacacatatgagtggagcagccggaactcaaacccaattacggcattcaacctaacaattatggctttttt |
38571720 |
T |
 |
| Q |
127 |
attagattagaacttgtggataagcctttgttttgtttgtgagaaatacattgtatcggtatgggatttttattttattatcattggaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38571721 |
attagattagaacttgtggataagcctttgttttgtttgtgagaaatacattgtatcggtatgggatttttattttattatcattggaaag |
38571811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University