View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20752_low_2 (Length: 269)
Name: NF20752_low_2
Description: NF20752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20752_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 130 - 255
Target Start/End: Complemental strand, 4829937 - 4829812
Alignment:
| Q |
130 |
gactttgggagtggtccatttgagctgttcgaactctgaacaccttctaaaagacatgttctacccactagactccttgcagaaaaacaaagactttgaa |
229 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4829937 |
gactttgggagtggtccacttgagctattcgaactctgaacaccttcttaaagacatgttctacccactagactccttgcagaaaaacgaagactttgaa |
4829838 |
T |
 |
| Q |
230 |
agtgcttaattctttctttgtgcccc |
255 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4829837 |
agtgcttaattctttctttgtgcccc |
4829812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University