View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20753_low_5 (Length: 428)
Name: NF20753_low_5
Description: NF20753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20753_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 4e-54; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 13 - 136
Target Start/End: Complemental strand, 53789496 - 53789373
Alignment:
| Q |
13 |
gaacctgtgtttagcgttggaatttcatgaaaataaaacggcgcataagatcagataagataacgacagggagatgtattagggtttttgttttcttctt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53789496 |
gaacctgagtttagcgttggaatttcatgacaataaaacggcgcataagatcagataagataaagacagggagatgtattagggtttttgttttcttctt |
53789397 |
T |
|
| Q |
113 |
gtgaaaaaagatgtattagggttt |
136 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
53789396 |
gtgagaaaagatgtattagggttt |
53789373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 351 - 413
Target Start/End: Complemental strand, 53789223 - 53789161
Alignment:
| Q |
351 |
tgttagttactttagtccttaacatttccaaaagtggtaactgttgcaaaatgaagaagaaaa |
413 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53789223 |
tgttagttactttagtccttaacattttcaaaagtggtaactgttgcaaaatgaagaagaaaa |
53789161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 53789284 - 53789236
Alignment:
| Q |
226 |
ttgatgaaatttgaaatgggcaaaccattacattgatccctaaaatgtc |
274 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53789284 |
ttgatgaaatttgaaatgggcaaaccactacattgatccctaaaatgtc |
53789236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 170 - 209
Target Start/End: Complemental strand, 53789310 - 53789271
Alignment:
| Q |
170 |
taatggtcaataattattattaataattgatgaaatttga |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53789310 |
taatggtcaataattatgattaataattgatgaaatttga |
53789271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University