View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20754_high_11 (Length: 212)
Name: NF20754_high_11
Description: NF20754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20754_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 26 - 174
Target Start/End: Original strand, 41022481 - 41022629
Alignment:
| Q |
26 |
gttgcttagtgtatttaagattgtgagaagagggtcttataagtggccctttgaaaaattcagcaactattgctcccattaatgatatcatcattccaat |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41022481 |
gttgcttagtgtatttaagattgtgagaagagggtcttataagtggccctttgaaaaattcagcaactattgctcccattaatgataccatcattccaat |
41022580 |
T |
 |
| Q |
126 |
tatttggacttggataccagagtttcttaaattcaactctaccttcctg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41022581 |
tatttggacttggataccagagtttcttaaattcaactctaccttcctg |
41022629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University